AAV Cag Flex H2B Gcamp6f reverse
(Plasmid #74155)

• Purpose: Calcium Sensor
• Depositing Lab: Loren Looger
• Publication: 1. AAV Synapsin Intron H2B Gcamp 6f wpre Pzac2.1 (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV CAG Flex
• Backbone size w/o insert (bp): 5009
• Total vector size (bp): 6771
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Gcamp6f
• Alt name: GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
• Species: R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
• Insert Size (bp): 1353
• Promoter: CAG
• Tag / Fusion Protein:
  • H2B (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: AAV 1145f: caaggctttcacgcagccacag
• 3′ sequencing primer: AAV 1621r : ctgacaacgggccacaactc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry