AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1
(Plasmid
#74150)
-
Purposecalcium sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74150 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV synapsin intron
- Backbone size w/o insert (bp) 4821
- Total vector size (bp) 6579
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
Alt nameGCaMP3-K78H T302L R303P D380Y T381R S383T R392G
-
SpeciesR. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
-
Insert Size (bp)1353
- Promoter Synapsin
-
Tag
/ Fusion Protein
- H2B (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NruI (destroyed during cloning)
- 3′ cloning site NruI (destroyed during cloning)
- 5′ sequencing primer Intron f; gtatcaaggttacaagacag
- 3′ sequencing primer AAV1621 r; gagttgtggcccgttgtcag (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector: AA0215 AAV Synapsin intron Pzac2.1 from Scott sternson lab hhmi/Jfrc.
Please note that the Addgene verified sequence was updated 2/25/22 due to an error in the original assembly. If you downloaded the sequence prior to this date, please note the transgene is in the opposite orientation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1 was a gift from Loren Looger (Addgene plasmid # 74150 ; http://n2t.net/addgene:74150 ; RRID:Addgene_74150)