AAV-hSyn-FlicR1
(Plasmid #74143)

• Purpose: Express FlicR1 preferentially in neurons
• Depositing Lab: Robert Campbell
• Publication: Abdelfattah et al J Neurosci. 2016 Feb 24;36(8):2458-72. doi: 10.1523/JNEUROSCI.3484-15.2016.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4557
• Total vector size (bp): 6018
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FlicR1
• Alt name: Fluorescent indicator for voltage imaging Red
• Species: Synthetic
• Insert Size (bp): 1461
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GAGGAGTCGTGTCGTGCC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry