-
PurposeExpress FlicR1 preferentially in neurons
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4557
- Total vector size (bp) 6018
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlicR1
-
Alt nameFluorescent indicator for voltage imaging Red
-
SpeciesSynthetic
-
Insert Size (bp)1461
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAGGAGTCGTGTCGTGCC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hSyn-FlicR1 was a gift from Robert Campbell (Addgene plasmid # 74143 ; http://n2t.net/addgene:74143 ; RRID:Addgene_74143) -
For your References section:
A Bright and Fast Red Fluorescent Protein Voltage Indicator That Reports Neuronal Activity in Organotypic Brain Slices. Abdelfattah AS, Farhi SL, Zhao Y, Brinks D, Zou P, Ruangkittisakul A, Platisa J, Pieribone VA, Ballanyi K, Cohen AE, Campbell RE. J Neurosci. 2016 Feb 24;36(8):2458-72. doi: 10.1523/JNEUROSCI.3484-15.2016. 10.1523/JNEUROSCI.3484-15.2016 PubMed 26911693
