CMV-FlicR1
(Plasmid #74142)

• Purpose: Mammalian expression of FlicR1: A bright red fluorescent genetically encoded voltage indicator
• Depositing Lab: Robert Campbell
• Publication: Abdelfattah et al J Neurosci. 2016 Feb 24;36(8):2458-72. doi: 10.1523/JNEUROSCI.3484-15.2016.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5546
• Total vector size (bp): 7043
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FlicR1
• Alt name: Fluorescent indicator for voltage imaging Red
• Species: Synthetic
• Insert Size (bp): 1497
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry