Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TRAP 4-mEOS
(Plasmid #74127)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74127 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNAS1B
  • Backbone size w/o insert (bp) 2376
  • Total vector size (bp) 3468
  • Modifications to backbone
    Modified pNAS1B duet vector (Addgene plasmid #61968). Removed the pBAD promoter and its expression construct.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TRAP 4 fused to mEOS3.2
  • Species
    Synthetic
  • Insert Size (bp)
    1092
  • Promoter PLTETO

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATACTGAGCACATCAGCAGGACG
  • 3′ sequencing primer GTAAGCCAGTATACACTCCGCTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRAP 4-mEOS was a gift from Lynne Regan (Addgene plasmid # 74127 ; http://n2t.net/addgene:74127 ; RRID:Addgene_74127)