pBP-Bba_K822000
(Plasmid #74094)

• Purpose: L-Lactate inducible promoter from E. coli MG1655
• Depositing Lab: Paul Freemont
• Publication: Moore et al ACS Synth Biol. 2016 May 2.

Backbone

• Vector backbone: pSB1C3
• Backbone manufacturer: iGEM
• Backbone size w/o insert (bp): 2044
• Total vector size (bp): 2439
• Modifications to backbone: Modifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bba_K822000 (L-Lactate promoter - E. coli MG1655)
• Species: E. coli MG1655
• Insert Size (bp): 340
• Promoter: NA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (not destroyed)
• 3′ cloning site: BsaI (not destroyed)
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry