Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTU2-A-RFP (colE1 origin)
(Plasmid #74093)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74093 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    colE1 origin and chloramphenicol resistance
  • Backbone manufacturer
    Terrence Lai (this study)
  • Backbone size w/o insert (bp) 1878
  • Total vector size (bp) 3140
  • Modifications to backbone
    Modifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Golden Gate destination vector - Level 2, 4 TU's with RFP and colE1 origin of replication
  • Species
    Synthetic
  • Promoter R0010 Const. Promoter controlling RFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer CTGACGTCTAAGAAACCATT
  • 3′ sequencing primer AACCGTATTACCGCCTTTGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTU2-A-RFP (colE1 origin) was a gift from Paul Freemont (Addgene plasmid # 74093 ; http://n2t.net/addgene:74093 ; RRID:Addgene_74093)
  • For your References section:

    EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology. Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. ACS Synth Biol. 2016 May 2. 10.1021/acssynbio.6b00031 PubMed 27096716