pTU2S-a (colE1 origin)
(Plasmid #74091)

• Purpose: Secondary module (BpiI) site in pTU2-a backbone with colE1 (medium-copy) origin of replication
• Depositing Lab: Paul Freemont
• Publication: Moore et al ACS Synth Biol. 2016 May 2.

Backbone

• Vector backbone: colE1 origin and chloramphenicol resistance
• Backbone manufacturer: Terrence Lai (this study)
• Backbone size w/o insert (bp): 1878
• Total vector size (bp): 1991
• Modifications to backbone: Modifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Golden Gate destination vector - Level 2, 2 TU's with secondary module and colE1 origin
• Species: Synthetic
• Promoter: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: CAGGGGATAACGCAGGAAAG
• 3′ sequencing primer: attaccgcctttgagtgagc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry