pTU2S-a (p15A origin)
(Plasmid #74088)

• Purpose: Secondary module (BpiI) site in pTU2-a backbone with p15A (low-copy) origin of replication
• Depositing Lab: Paul Freemont
• Publication: Moore et al ACS Synth Biol. 2016 May 2.

Backbone

• Vector backbone: p15A origin and chloramphenicol resistance
• Backbone manufacturer: Terrence Lai (this study)
• Backbone size w/o insert (bp): 2024
• Total vector size (bp): 2137
• Modifications to backbone: Modifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 10 ml LB culture - use 2X P1, P2 and N3 buffer for mini-prep purification and concentrate elution fraction (~10-20 ng/ul in 50 ul total volume of water) until 50 ng/ul for Golden Gate
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Golden Gate destination vector - Level 2, 2 TU's with secondary module and p15A origin
• Species: Synthetic
• Promoter: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: CAGGGGATAACGCAGGAAAG
• 3′ sequencing primer: AACCGTATTACCGCCTTTGA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry