pAL-pgi_NT
(Plasmid
#74067)
-
PurposepAL374 plasmid carrying the pgi (NT) sgRNA, targeting the non-template strand of pgi, SpecR
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAL374
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA pgi (NT)
-
gRNA/shRNA sequencepgi (NT)
-
SpeciesSynthetic
- Promoter ptac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAGCCATCGGAAGCTGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAL-pgi_NT was a gift from Timothy Lu (Addgene plasmid # 74067 ; http://n2t.net/addgene:74067 ; RRID:Addgene_74067) -
For your References section:
Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). Cleto S, Jensen JV, Wendisch VF, Lu TK. ACS Synth Biol. 2016 Feb 16. 10.1021/acssynbio.5b00216 PubMed 26829286
Map uploaded by the depositor.
