pMIG-hNFATc1/bC - AVITEV
(Plasmid #74059)

• Purpose: retroviral expression plasmid for human NFATc1/bC with C-terminal BirA-biotinylation signal and TEV celavage site
• Depositing Lab: Ria Baumgrass
• Publication: Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.

Backbone

• Vector backbone: pMSCV-IRES-GFP (pMIG)
• Backbone size w/o insert (bp): 7200
• Total vector size (bp): 9956
• Modifications to backbone: added SV40-Ori
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human NFATc1, isoform beta-C
• Alt name: NFAT2
• Species: H. sapiens (human)
• Insert Size (bp): 2900
• GenBank ID: NM_172387 ID: 4772
• Entrez Gene: NFATC1 (a.k.a. NF-ATC, NF-ATc1.2, NFAT2, NFATc)
• Promoter: pMSCV-LTRs
• Tag / Fusion Protein:
  • AVI-TEV (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: swaI (not destroyed)
• 3′ cloning site: SnaB1, Sgf1 (not destroyed)
• 5′ sequencing primer: CGTTCGACCCCGCCTCGATCC
• 3′ sequencing primer: AGCTTGATATCGAATTCCG

Resource Information

• Supplemental Documents:
  • AVITEV-vector cloning site
• A portion of this plasmid was derived from a plasmid made by: sequence synthesis by company

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.