pMSCV-AVITEV-GFP
(Plasmid #74052)

• Purpose: retroviral expression plasmid for GFP with N-terminal BirA-biotinylation signal and TEV celavage site
• Depositing Lab: Ria Baumgrass
• Publication: Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.

Backbone

• Vector backbone: pMSCV-IRES-GFP (pMIG)
• Backbone size w/o insert (bp): 5200
• Total vector size (bp): 6090
• Modifications to backbone: IRES site from pMIG was replaced by N-terminal AVITEV tag in frame to the GFP, resulting in AVITEV-GFP expression
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AVITEV-GFP
• Insert Size (bp): 800
• Promoter: pMSCV-LTRs
• Tag / Fusion Protein:
  • AVI-TEV-tag N-terminal to the GFP (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGTTCGACCCCGCCTCGATCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: standard pMIG-Vector

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.