pMIG-hNFATc2
(Plasmid #74050)

• Purpose: retroviral expression plasmid for human NFATc2/C
• Depositing Lab: Ria Baumgrass
• Publication: Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.

Backbone

• Vector backbone: pMSCV-IRES-GFP (pMIG)
• Backbone size w/o insert (bp): 7200
• Total vector size (bp): 9851
• Modifications to backbone: added SV40 ori
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human NFATc2, isoform C
• Alt name: NFAT1
• Alt name: nuclear factor of activated T-cells 2
• Species: H. sapiens (human)
• Insert Size (bp): 2700
• Mutation: silent mutation A1723C in the sequence of NM_173091.3 (A1503C position in ORF of the vector)
• GenBank ID: NM_173091.3 Gene-ID: 4773
• Entrez Gene: NFATC2 (a.k.a. JCOSL, NFAT1, NFATP)
• Promoter: pMSCV-LTRs
• Tag / Fusion Protein:
  • no tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (not destroyed)
• 3′ cloning site: Sgf1 (not destroyed)
• 5′ sequencing primer: CGTTCGACCCCGCCTCGATCC
• 3′ sequencing primer: AGCTTGATATCGAATTCCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid may be particularly prone to recombination; please screen multiple colonies by restriction analysis before selecting a clone to perform downstream experiments