pMSCV-FLAG-hIKAROS-IRES-GFP
(Plasmid #74046)

• Purpose: retroviral plasmid for expression of FLAG-tagged human Ikaros corresponding to cDNA from XM_011515058.1
• Depositing Lab: Ria Baumgrass
• Publication: Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.

Backbone

• Vector backbone: pMSCV-IRES-GFP (pMIG)
• Backbone size w/o insert (bp): 7200
• Total vector size (bp): 8721
• Modifications to backbone: sv40 ori added
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human Ikaros (IKZF1)
• Alt name: IKZF1
• Species: H. sapiens (human)
• Insert Size (bp): 1650
• GenBank ID: XM_011515058.1
• Entrez Gene: IKZF1 (a.k.a. CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1)
• Promoter: pMSCV-LTRs
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (not destroyed)
• 3′ cloning site: XHO1 (not destroyed)
• 5′ sequencing primer: CGTTCGACCCCGCCTCGATCC
• 3′ sequencing primer: AGCTTGATATCGAATTCCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cloned from cDNA (human CD4+ cells), corresponds to ORF from transcript variants X1, X3, X5-X9

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry