pTE4396
(Plasmid #74041)

• Purpose: Expresses human codon-optimized AsCpf1 and As crRNA.
• Depositing Lab: Ervin Welker
• Publication: Toth et al Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 4642
• Total vector size (bp): 9677
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: As crRNA
• Alt name: Acidaminococcus sp. CRISPR RNA
• Insert Size (bp): 47
• Promoter: human U6

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: AAAACAGGAAGGCAAAATGC

Gene/Insert 2

• Gene/Insert name: AsCpf1
• Alt name: AsCas12a
• Alt name: Acidaminococcus sp. Cpf1 nuclease
• Insert Size (bp): 3921
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry