FH95pUp95bGW (B5)
(Plasmid
#74014)
-
Purposelentiviral expression of shRNA resistant Psd95-beta-EGFP fusion and Psd95 shRNA
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerDavid Baltimore (Addgene plasmid # 14883)
- Backbone size w/o insert (bp) 9941
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePsd95 shRNA
-
Alt nameshRNA-resistant Psd95-EGFP fusion co-expressed
-
gRNA/shRNA sequenceGGA CAT CCA GGC ACA CAA G
-
SpeciesR. norvegicus (rat)
-
Entrez GeneDlg4 (a.k.a. Dlgh4, PSD95, Sap90)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BstBI (destroyed during cloning)
- 5′ sequencing primer H1 tcgctatgtgttctgggaaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Map: FHUG+W-HinDIII-SalI-XbaI-(p95b)-KpnI-SacII-PspOMI-SmaI-BamHI-(GFP)-BglII-BsrBI-EcoRV-HinDIII-ClaI
Also associated with Liu, et al. J Neurophysiol. 2014 Feb;111(3):648-58. doi: 10.1152/jn.00262.2013 PMID 24225540.
Psd95 shRNA expressed under control of H1 promoter. Psd95 coding sequence modified to GGATATTCAAGCGCATAAG make it resistant to the shRNA. Psd95-EGFP fusion protein expressed under control of UbC promoter.
The publication by Schluter et al linked above describes the creation of the beta isoform of Psd95 in detail
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FH95pUp95bGW (B5) was a gift from Robert Malenka & Oliver Schluter & Weifeng Xu (Addgene plasmid # 74014 ; http://n2t.net/addgene:74014 ; RRID:Addgene_74014) -
For your References section:
Alternative N-terminal domains of PSD-95 and SAP97 govern activity-dependent regulation of synaptic AMPA receptor function. Schluter OM, Xu W, Malenka RC. Neuron. 2006 Jul 6;51(1):99-111. 10.1016/j.neuron.2006.05.016 PubMed 16815335