Skip to main content
Addgene

CpcB-Picea-sitchensisPHLS_CpcA
(Plasmid #74001)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74001 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2877
  • Total vector size (bp) 7093

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHLS and CmR
  • Alt name
    Picea sitchensis phellandrene synthase (PHLS) fused to CpcB plus CmR
  • Species
    Synechocystis and Picea sitchensis
  • Insert Size (bp)
    4216
  • GenBank ID
    ADZ45506.1 AGF50922.1
  • Promoter cpc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer aagagtccctgaatatcaaa
  • 3′ sequencing primer ctagctcagagcattgatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CpcB-Picea-sitchensisPHLS_CpcA was a gift from Anastasios Melis (Addgene plasmid # 74001 ; http://n2t.net/addgene:74001 ; RRID:Addgene_74001)
  • For your References section:

    Cyanobacterial production of plant essential oils. Formighieri C, Melis A. Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4. 10.1007/s00425-018-2948-0 PubMed 29974209