pAAV-SEPT_Cdk2-T160E-siR
(Plasmid
#73976)
-
PurposeHDR template to generate Cdk2-T160E-siR
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-SEPT
- Backbone size w/o insert (bp) 5020
- Total vector size (bp) 7105
-
Vector typeAAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCdk2-LHA-siR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1075
-
MutationsiRNA target site mutated
-
GenBank IDNM_001798
-
Entrez GeneCDK2 (a.k.a. CDKN2, p33(CDK2))
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (unknown if destroyed)
- 3′ cloning site Sac1 (unknown if destroyed)
- 5′ sequencing primer ggcgcgccggagaggtgggttgggggccagtagaagg
- 3′ sequencing primer gagctcgcagggaaggagacacaaaaagaagggg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCdk2-RHA-T160E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1031
-
MutationT160 mutated to Glu
-
GenBank IDNM_001798
-
Entrez GeneCDK2 (a.k.a. CDKN2, p33(CDK2))
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Cla1 (unknown if destroyed)
- 3′ cloning site Sal1 (unknown if destroyed)
- 5′ sequencing primer ATCGAT ccctagggttggactgaacaatcaaagttg
- 3′ sequencing primer GTCGAC gtttccttccctccatcatctttcccctccc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SEPT_Cdk2-T160E-siR was a gift from Steven Dowdy & Manuel Kaulich (Addgene plasmid # 73976 ; http://n2t.net/addgene:73976 ; RRID:Addgene_73976) -
For your References section:
Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi. Kaulich M, Lee YJ, Lonn P, Springer AD, Meade BR, Dowdy SF. Nucleic Acids Res. 2015 Apr 20;43(7):e45. doi: 10.1093/nar/gku1403. Epub 2015 Jan 13. 10.1093/nar/gku1403 PubMed 25586224