Skip to main content
Addgene

pAAV-SEPT_Cdk2-T160A-siR
(Plasmid #73975)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73975 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-SEPT
  • Backbone size w/o insert (bp) 5020
  • Total vector size (bp) 7105
  • Vector type
    AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cdk2-LHA-siR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1075
  • Mutation
    siRNA target site mutated
  • GenBank ID
    NC_000012.12
  • Entrez Gene
    CDK2 (a.k.a. CDKN2, p33(CDK2))

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (unknown if destroyed)
  • 3′ cloning site Sac1 (unknown if destroyed)
  • 5′ sequencing primer gcg GGCGCGCC ggagaggtgggttgggggccagtagaagg
  • 3′ sequencing primer gcg GAGCTC gcagggaaggagacacaaaaagaagggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cdk2-RHA-T160A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1031
  • Mutation
    T160 mutated to Ala
  • GenBank ID
    NC_000012.12
  • Entrez Gene
    CDK2 (a.k.a. CDKN2, p33(CDK2))

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (unknown if destroyed)
  • 3′ cloning site Sal1 (unknown if destroyed)
  • 5′ sequencing primer gcg ATCGAT ccctagggttggactgaacaatcaaagttg
  • 3′ sequencing primer gcg GTCGAC gtttccttccctccatcatctttcccctccc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SEPT_Cdk2-T160A-siR was a gift from Steven Dowdy & Manuel Kaulich (Addgene plasmid # 73975 ; http://n2t.net/addgene:73975 ; RRID:Addgene_73975)
  • For your References section:

    Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi. Kaulich M, Lee YJ, Lonn P, Springer AD, Meade BR, Dowdy SF. Nucleic Acids Res. 2015 Apr 20;43(7):e45. doi: 10.1093/nar/gku1403. Epub 2015 Jan 13. 10.1093/nar/gku1403 PubMed 25586224