pJFRC7-RFPnls-PQRv2-mCD8:GFP
(Plasmid #73974)

• Purpose: Protein Quantitation Reporter (PQR) to quantify a protein of interest in insect cells.
• Depositing Lab: Brian Chen
• Publication: Lo et al Cell Rep. 2015 Dec 22;13(11):2634-44. doi: 10.1016/j.celrep.2015.11.048. Epub 2015 Dec 10.

Backbone

• Vector backbone: pJFRC7
• Backbone manufacturer: Janelia Farms
• Backbone size w/o insert (bp): 8142
• Total vector size (bp): 10235
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sfGFP
• Alt name: superfolder GFP
• Insert Size (bp): 1202
• Promoter: 20XUAS-HS
• Tag / Fusion Protein:
  • mCD8 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCCACCTGATCTGCAAC
• 3′ sequencing primer: CCATTCATCAGTTCCATAGG

Gene/Insert 2

• Gene/Insert name: RFP
• Alt name: TagRFP-T
• Species: D. melanogaster (fly)
• Insert Size (bp): 816
• Promoter: 20XUAS-HS
• Tag / Fusion Protein:
  • nls (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGCGCCGGAGTATAAATAGAG
• 3′ sequencing primer: TCTGGAAGAGCCAAGAGCAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: all genes were synthesized

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry