pcDNA3-Myc-NLRP3(R260W)
(Plasmid #73956)

• Purpose: Express c-Myc-tagged human NLRP3(R260W) in mammalian cells
• Depositing Lab: Christian Stehlik
• Publication: Dorfleutner et al Infect Immun. 2007 Mar;75(3):1484-92. Epub 2006 Dec 18.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5459
• Total vector size (bp): 8700
• Modifications to backbone: A c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLR family, pyrin domain containing 3 (NLRP3)
• Species: H. sapiens (human)
• Insert Size (bp): 3200
• Mutation: R260W
• GenBank ID: NM_004895.4
• Entrez Gene: NLRP3 (a.k.a. AGTAVPRL, AII, AVP, C1orf7, CIAS1, CLR1.1, DFNA34, FCAS, FCAS1, FCU, KEFH, MWS, NALP3, PYPAF1)
• Promoter: CMV iE
• Tag / Fusion Protein:
  • c-myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: XhoI1 (not destroyed)
• 5′ sequencing primer: T7 promoter (TAATACGACTCACTATAGGG)
• 3′ sequencing primer: SP6 promoter (ATTTAGGTGACACTATAG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry