pcDNA3-Myc-ASC
(Plasmid #73952)

• Purpose: Express c-Myc-tagged human ASC in mammalian cells
• Depositing Lab: Christian Stehlik
• Publication: Bryan et al J Immunol. 2009 Mar 1;182(5):3173-82. doi: 10.4049/jimmunol.0802367.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5459
• Total vector size (bp): 6100
• Modifications to backbone: A c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PYD and CARD domain containing, PYCARD
• Alt name: ASC
• Alt name: TMS-1
• Species: H. sapiens (human)
• Insert Size (bp): 636
• GenBank ID: NM_013258.4
• Entrez Gene: PYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
• Promoter: CMV
• Tag / Fusion Protein:
  • c-myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: T7 promoter (TAATACGACTCACTATAGGG)
• 3′ sequencing primer: SP6 promoter (ATTTAGGTGACACTATAG)

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry