pMA7CR_2.0
(Plasmid #73950)

• Purpose: pMA7CR_2.0 contains arabinose inducible λ/RED β-protein and dam, and aTc inducible CRISPR/Cas9 and recX
• Depositing Lab: Alex Nielsen
• Publication: Ronda et al Sci Rep. 2016 Jan 22;6:19452. doi: 10.1038/srep19452.

Backbone

• Vector backbone: pBAD24
• Total vector size (bp): 10959
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: cas9
• Species: Bacteria
• Insert Size (bp): 4107
• Promoter: pTet

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tttgttgcgcgctttatcgc
• 3′ sequencing primer: gcgacacggaaatgttgaat

Gene/Insert 2

• Gene/Insert name: lambda beta
• Insert Size (bp): 786
• Promoter: pAra

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tgccatagcatttttatccat
• 3′ sequencing primer: taaggcggatcgcaatagac

Gene/Insert 3

• Gene/Insert name: dam
• Insert Size (bp): 837
• Promoter: pAra

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gtcgacccacaggaactgat
• 3′ sequencing primer: ccgccaggcaaattctgt

Gene/Insert 4

• Gene/Insert name: recX
• Insert Size (bp): 501
• Promoter: pTet

Cloning Information for Gene/Insert 4

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tatctgttgtttgtcggtgaacg
• 3′ sequencing primer: gcggtctgtatttcccagaa

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry