pGex-4T-2_GABARAP
(Plasmid #73948)

• Purpose: For recombinant expression of human GABARAP in E.coli
• Depositing Lab: Dieter Willbold
• Publication: Stangler et al J Biomol NMR. 2001 Oct;21(2):183-4.

Backbone

• Vector backbone: pGex-4T-2
• Backbone manufacturer: GE Healthcare Life Sciences
• Backbone size w/o insert (bp): 4970
• Total vector size (bp): 5320
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GABARAP
• Species: H. sapiens (human)
• Insert Size (bp): 351
• Entrez Gene: GABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: CCAGCAAGTATATAGCATGG
• 3′ sequencing primer: GCTTACAGACAAGCTGTGAC

Resource Information

• Supplemental Documents:
  • pGex-4T-2_GABARAP
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry