-
PurposeFor recombinant expression of human LC3A/MAP1LC3A in E. coli
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGex-4T-2
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 5320
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLC3A
-
Alt nameMAP1LC3A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)363
-
Entrez GeneMAP1LC3A (a.k.a. ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCAGCAAGTATATAGCATGG
- 3′ sequencing primer GCTTACAGACAAGCTGTGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGex-4T-2_LC3A was a gift from Dieter Willbold (Addgene plasmid # 73946 ; http://n2t.net/addgene:73946 ; RRID:Addgene_73946) -
For your References section:
Interaction of Bcl-2 with the autophagy-related GABAA receptor-associated protein (GABARAP): biophysical characterization and functional implications. Ma P, Schwarten M, Schneider L, Boeske A, Henke N, Lisak D, Weber S, Mohrluder J, Stoldt M, Strodel B, Methner A, Hoffmann S, Weiergraber OH, Willbold D. J Biol Chem. 2013 Dec 27;288(52):37204-15. doi: 10.1074/jbc.M113.528067. Epub 2013 Nov 15. 10.1074/jbc.M113.528067 PubMed 24240096