pBF_HsPepT1
(Plasmid #73943)

• Purpose: Xenopus oocyte expression vector containing the cDNA of human PepT1 with a c terminal flag tag
• Depositing Lab: Simon Newstead
• Publication: Beale et al Structure. 2015 Oct 6;23(10):1889-99. doi: 10.1016/j.str.2015.07.016. Epub 2015 Aug 27.

Backbone

• Vector backbone: pBF
• Backbone size w/o insert (bp): 3003
• Total vector size (bp): 5225
• Vector type: make RNA for Xenopus oocyte injection

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PepT1
• Alt name: SLC15A1
• Species: H. sapiens (human)
• Insert Size (bp): 2120
• Entrez Gene: SLC15A1 (a.k.a. HPECT1, HPEPT1, PEPT1)
• Promoter: beta globin
• Tag / Fusion Protein:
  • Flag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHi (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: TTGTTCTTTTTGCAGAAGC
• 3′ sequencing primer: GCTTAGAGACTCCATTCGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry