pGEX6P1- Mst7-Erp1CT
(Plasmid
#73920)
-
PurposeGST fusion- Erp1 cytoplasmic tail
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX6P1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameErp1 CT
-
SpeciesS. cerevisiae (budding yeast)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Cla1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer ACGTTTGGTGGTGGCGACCATCCTCCAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1- Mst7-Erp1CT was a gift from Blanche Schwappach (Addgene plasmid # 73920 ; http://n2t.net/addgene:73920 ; RRID:Addgene_73920) -
For your References section:
delta-COP contains a helix C-terminal to its longin domain key to COPI dynamics and function. Arakel EC, Richter KP, Clancy A, Schwappach B. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6916-21. doi: 10.1073/pnas.1603544113. Epub 2016 Jun 13. 10.1073/pnas.1603544113 PubMed 27298352