act-AsCpf1
(Plasmid #73917)

• Purpose: expression plasmid of AsCpf1
• Depositing Lab: Simon Bullock
• Publication: Port et al Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5.

Backbone

• Vector backbone: pact
• Backbone manufacturer: gift from Silvia Aldaz
• Backbone size w/o insert (bp): 12429
• Total vector size (bp): 16571
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hAsCpf1
• Alt name: human codon-optimized AsCas12a
• Species: H. sapiens (human)
• Insert Size (bp): 4059
• Promoter: act5C
• Tag / Fusion Protein:
  • NLS-3xHA (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTTCTACATTACCAAATAAGG
• 3′ sequencing primer: AAATCTCTGTAGGTAGTTTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hAsCpf1 from Feng Zhang (Addgene plasmid 69982).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit crisprflydesign.org for more information.

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.