-
PurposegRNA vector for AsCpf1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepValium22
-
Backbone manufacturerNorbert Perrimon, Jian-Quan Ni, Harvard
- Total vector size (bp) 6248
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametRNA:hAsCpf1-gRNA:tRNA
-
gRNA/shRNA sequenceempty
-
SpeciesH. sapiens (human), D. melanogaster (fly)
- Promoter dU6:3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGTTTTATAACTTATGCCCCTAAG
- 3′ sequencing primer GCCGAGCACAATTGTCTAGAATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.
Visit crisprflydesign.org for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD7 was a gift from Simon Bullock (Addgene plasmid # 73916 ; http://n2t.net/addgene:73916 ; RRID:Addgene_73916) -
For your References section:
Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Port F, Bullock SL. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5. 10.1038/nmeth.3972 PubMed 27595403