pMAL_dstβL
(Plasmid
#73805)
-
PurposePlasmid for selection for insertion and homodimerization
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73805 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmal 27
- Backbone size w/o insert (bp) 6272
-
Modifications to backboneRemoved MBP tag Changed MCS restriction sites Added Ampicillin resistance
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCAT Marker
-
Speciese.coli
-
Insert Size (bp)1006
- Promoter NaN
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GGAGTGGTGAATCCGTTAGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameToxR
-
Alt nameToxR
-
Speciesecoli
-
Insert Size (bp)811
- Promoter ToxR promotor
-
Tag
/ Fusion Protein
- Part of the dsTbL chimera (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCCTGGGAATTCTTGAAGACGAAAGGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namebeta lactamase
-
Speciese. coli
- Promoter ToxR promotor
-
Tag
/ Fusion Protein
- part of the dstbl chiemra (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CGACTCTGCGCAAAATGCTCAAAGATTCGACAAAGTCCCC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namespectomycin resistance
-
Speciese.coli
-
Insert Size (bp)966
- Promoter NaN
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer GGTTTACACTTACTTTAGTTTTATGG (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameCLS TM domain
-
Speciese.coli
-
Insert Size (bp)87
-
Tag
/ Fusion Protein
- Part Of the dstbl chiemra (N terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe p-Mal plasmid was generously provided by the Mark Lemmon laboratory
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL_dstβL was a gift from Sarel Fleishman (Addgene plasmid # 73805 ; http://n2t.net/addgene:73805 ; RRID:Addgene_73805) -
For your References section:
Mutational scanning reveals the determinants of protein insertion and association energetics in the plasma membrane. Elazar A, Weinstein J, Biran I, Fridman Y, Bibi E, Fleishman SJ. Elife. 2016 Jan 29;5. pii: e12125. doi: 10.7554/eLife.12125. 10.7554/eLife.12125 PubMed 26824389
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/73/73805/73805-map_94g3VUT6uBs1.jpg.940x940_q85_autocrop.png)