pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
(Plasmid #73796)

• Purpose: pRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNA
• Depositing Lab: Ronald Davis
• Publication: Smith et al Genome Biol. 2016 Mar 8;17(1):45. doi: 10.1186/s13059-016-0900-9.

Backbone

• Vector backbone: pRS416
• Backbone manufacturer: https://www.addgene.org/vector-database/3985/
• Backbone size w/o insert (bp): 4898
• Total vector size (bp): 12554
• Modifications to backbone: Cut between multiple cloning site and PciI site outside of the multiple cloning site so part of vector is missing
• Vector type: Yeast Expression, CRISPR
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: dCas9-Mxi1
• Species: Synthetic; S pyogenes Cas9
• Insert Size (bp): 4344
• Mutation: D10A, H840A
• Promoter: pTef1
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • Mxi1 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCTTTCGATGACCTCCCATTG
• 3′ sequencing primer: gtaatacgactcactataggg

Gene/Insert 2

• Gene/Insert name: Tet Repressor
• Alt name: TetR
• Species: Bacterial
• Insert Size (bp): 624
• Promoter: pGPM1

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagtacaaacgcatgaaatcc
• 3′ sequencing primer: CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG

Gene/Insert 3

• Gene/Insert name: Structural gRNA for S pyogenes
• Alt name: sgRNA
• Species: Synthetic; S pyogenes
• Insert Size (bp): 82
• Promoter: pRPR1(TetO)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagcaacgcggcctttttacggttcctggcc
• 3′ sequencing primer: CAGGAAAGACCGCGGcttaaagtcatacattgcacgacta

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• A portion of this plasmid was derived from a plasmid made by: Cas9 gene was received from DiCarlo et al.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Detailed benchling plasmid map available at: https://benchling.com/s/0WUKQB/edit
All annotations are available there. This is best reference to use for this plasmid. The genbank file included was exported from benchling for this plasmid.

Please note to clone in gRNAs you need to use Gibson Assembly. Gibson will chew back the NotI overhangs. Provide homology on either side of the cut site to clone. Generally we order 60mers with 20bp of homology to the promoter and to the terminator. For high efficiency amplify with primers that extend these homologies to 30-40bp. You can directly clone in single stranded oligo with 20bp overlaps using Gibson if you only need low efficiency. To do this use ~100x oligo to plasmid. For double stranded PCR product, use ratios between to 2:1 to 10:1 insert to plasmid. See paper methods for more details.