HA-mRIPK3 K51A-Flag/cHA-pTRIPZ vector
(Plasmid
#73704)
-
Purposelentiviral expression of mRIPK3 mutant
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRIPZ
-
Backbone manufacturerGE Dharmacon
- Backbone size w/o insert (bp) 12300
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRIPK3
-
SpeciesM. musculus (mouse)
-
MutationK51A
-
Entrez GeneRipk3 (a.k.a. 2610528K09Rik, Rip3)
- Promoter CMV/tet
-
Tags
/ Fusion Proteins
- HA (N terminal on backbone)
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer acggtgggaggcctatataagc
- 3′ sequencing primer tcgctgcgcccttcgtctgacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-mRIPK3 K51A-Flag/cHA-pTRIPZ vector was a gift from Francis Chan (Addgene plasmid # 73704 ; http://n2t.net/addgene:73704 ; RRID:Addgene_73704)