Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pS2-FLAG-Sestrin2-E451A
(Plasmid #73679)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73679 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pS2
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 9443
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sesn2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1443
  • Mutation
    E451A changed Glutamate 451 to Alanine
  • GenBank ID
    NM_031459.4 CDS
  • Entrez Gene
    SESN2 (a.k.a. HI95, SES2, SEST2)
  • Promoter Sesn2
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer CCCGAGGCCAGGGGGAGCAG
  • 3′ sequencing primer TAG TTT GTA TGT CTG TTG CTA TTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS2-FLAG-Sestrin2-E451A was a gift from David Sabatini (Addgene plasmid # 73679 ; http://n2t.net/addgene:73679 ; RRID:Addgene_73679)
  • For your References section:

    Sestrin2 is a leucine sensor for the mTORC1 pathway. Wolfson RL, Chantranupong L, Saxton RA, Shen K, Scaria SM, Cantor JR, Sabatini DM. Science. 2016 Jan 1;351(6268):43-8. doi: 10.1126/science.aab2674. Epub 2015 Oct 8. 10.1126/science.aab2674 PubMed 26449471