pccGFPGpA
(Plasmid
#73651)
-
PurposeFluorescent reporter for transmembrane protein dimerization positive control.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepccGFPKAN
- Backbone size w/o insert (bp) 7375
- Total vector size (bp) 7414
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameglycophorin A
-
Alt nameGpA
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer catgactttgtttggcgagagcaag (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pccGFPGpA was a gift from Alessandro Senes (Addgene plasmid # 73651 ; http://n2t.net/addgene:73651 ; RRID:Addgene_73651) -
For your References section:
Screening for transmembrane association in divisome proteins using TOXGREEN, a high-throughput variant of the TOXCAT assay. Armstrong CR, Senes A. Biochim Biophys Acta. 2016 Jul 21. pii: S0005-2736(16)30251-6. doi: 10.1016/j.bbamem.2016.07.008. 10.1016/j.bbamem.2016.07.008 PubMed 27453198