pccGFPG83I
(Plasmid #73650)

• Purpose: Fluorescent reporter for transmembrane protein dimerization negative control.
• Depositing Lab: Alessandro Senes
• Publication: Armstrong et al Biochim Biophys Acta. 2016 Jul 21. pii: S0005-2736(16)30251-6. doi: 10.1016/j.bbamem.2016.07.008.

Backbone

• Vector backbone: pccGFPKAN
• Backbone size w/o insert (bp): 7375
• Total vector size (bp): 7414
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: glycophorin A- G83I
• Alt name: GpA-G83I
• Species: H. sapiens (human)
• Insert Size (bp): 39
• Mutation: glycine 83 to isoleucine

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: catgactttgtttggcgagagcaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Engelman Lab
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry