pDEST-ORF-V1
(Plasmid #73637)

• Purpose: (Empty Backbone) Gateway™ destination vector encoding C-terminal fusion with Venus fluorescent protein fragment 1 (V1)
• Depositing Lab: Darren Saunders
• Publication: Croucher et al Sci Signal. 2016 Jul 12;9(436):ra69. doi: 10.1126/scisignal.aaf0793.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size (bp): 5439
• Modifications to backbone: Insertion of Gateway compatible recombination site. Insertion of Venus fluorescent protein fragment (V1) downstream and in frame of Gateway compatible recombination site.
• Vector type: Mammalian Expression
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus fragment 1 (V1) (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CGCACCATCTTCTTCAAG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Supplemental Documents:
  • pDEST-ORF-V1 Snapgene annotated
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Venus fragment was a kind gift from Prof. Stephen Michnick (University of Montreal). Plasmid built by Darren N. Saunders, Adrian Wan and Joseph Lau.
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry