pNIA-CEN-FLAG-LINXa4-Bre1
(Plasmid
#73617)
-
PurposeControl of the E3 ligase Bre1 with LINXa in yeast.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73617 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNIA-CEN
- Backbone size w/o insert (bp) 8084
- Total vector size (bp) 10700
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLINXa4-Bre1dNLS
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Avena Sativa
-
Insert Size (bp)2616
-
MutationBre1 point mutations K8A, K9A and K11A
- Promoter ADH1
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GTCATTGTTCTCGTTCCCTTTCTTCCTTG
- 3′ sequencing primer GGGACCTAGACTTCAGGTTGTCTAACTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNIA-CEN-FLAG-LINXa4-Bre1 was a gift from Brian Kuhlman (Addgene plasmid # 73617 ; http://n2t.net/addgene:73617 ; RRID:Addgene_73617) -
For your References section:
Light-induced nuclear export reveals rapid dynamics of epigenetic modifications. Yumerefendi H, Lerner AM, Zimmerman SP, Hahn K, Bear JE, Strahl BD, Kuhlman B. Nat Chem Biol. 2016 Jun;12(6):399-401. doi: 10.1038/nchembio.2068. Epub 2016 Apr 18. 10.1038/nchembio.2068 PubMed 27089030