Skip to main content
Addgene

pLenti-CMV-mOC-STAMP (N162D)-GFP
(Plasmid #73580)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73580 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti-CMV-MCS-GFP-SV-puro
  • Backbone size w/o insert (bp) 8437
  • Total vector size (bp) 9934
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OC-STAMP
  • Species
    M. musculus (mouse)
  • Mutation
    changed asparagin (N) 162 to Aspartic Acid (D)
  • Entrez Gene
    Ocstamp (a.k.a. 4833422F24Rik, OC-STAMP)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer tcttaggcaatgtgcgtgcag
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-mOC-STAMP (N162D)-GFP was a gift from Paul Odgren (Addgene plasmid # 73580 ; http://n2t.net/addgene:73580 ; RRID:Addgene_73580)

  • For your References section:

    Studies of OC-STAMP in Osteoclast Fusion: A New Knockout Mouse Model, Rescue of Cell Fusion, and Transmembrane Topology. Witwicka H, Hwang SY, Reyes-Gutierrez P, Jia H, Odgren PE, Donahue LR, Birnbaum MJ, Odgren PR. PLoS One. 2015 Jun 4;10(6):e0128275. doi: 10.1371/journal.pone.0128275. eCollection 2015. PONE-D-14-50827 [pii] PubMed 26042409
Related items: