Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mOC-STAMP (N162D)_3xFlag-Myc-CMV26
(Plasmid #73578)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73578 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    3xFlag-Myc-CMV26
  • Backbone manufacturer
    Sigma Aldrich
  • Backbone size w/o insert (bp) 6332
  • Total vector size (bp) 7829
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OC-STAMP
  • Species
    M. musculus (mouse)
  • Mutation
    changed asparagin (N) 162 to Aspartic Acid (D)
  • GenBank ID
    NM_029021.1
  • Entrez Gene
    Ocstamp (a.k.a. 4833422F24Rik, OC-STAMP)
  • Tags / Fusion Proteins
    • 3x Flag (N terminal on backbone)
    • c-Myc tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (unknown if destroyed)
  • 3′ cloning site EcoRV (unknown if destroyed)
  • 5′ sequencing primer tcttaggcaatgtgcgtgcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mOC-STAMP (N162D)_3xFlag-Myc-CMV26 was a gift from Paul Odgren (Addgene plasmid # 73578 ; http://n2t.net/addgene:73578 ; RRID:Addgene_73578)
  • For your References section:

    Studies of OC-STAMP in Osteoclast Fusion: A New Knockout Mouse Model, Rescue of Cell Fusion, and Transmembrane Topology. Witwicka H, Hwang SY, Reyes-Gutierrez P, Jia H, Odgren PE, Donahue LR, Birnbaum MJ, Odgren PR. PLoS One. 2015 Jun 4;10(6):e0128275. doi: 10.1371/journal.pone.0128275. eCollection 2015. PONE-D-14-50827 [pii] PubMed 26042409