-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 5000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Turbo
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepAzFRS.1.t1
-
SpeciesSynthetic
-
Insert Size (bp)921
-
GenBank IDKT996138
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site bglII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer cataagattagcggatcctacctg
- 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepAzFRS.1.t1
-
Insert Size (bp)921
-
GenBank IDKT996138
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEvol-pAzFRS.1.t1 was a gift from Farren Isaacs (Addgene plasmid # 73547 ; http://n2t.net/addgene:73547 ; RRID:Addgene_73547) -
For your References section:
Evolution of translation machinery in recoded bacteria enables multi-site incorporation of nonstandard amino acids. Amiram M, Haimovich AD, Fan C, Wang YS, Aerni HR, Ntai I, Moonan DW, Ma NJ, Rovner AJ, Hong SH, Kelleher NL, Goodman AL, Jewett MC, Soll D, Rinehart J, Isaacs FJ. Nat Biotechnol. 2015 Dec;33(12):1272-1279. doi: 10.1038/nbt.3372. Epub 2015 Nov 16. 10.1038/nbt.3372 PubMed 26571098