pEvol-pAzFRS.2.t1
(Plasmid #73546)

• Purpose: tRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAG
• Depositing Lab: Farren Isaacs
• Publication: Amiram et al Nat Biotechnol. 2015 Dec;33(12):1272-1279. doi: 10.1038/nbt.3372. Epub 2015 Nov 16.

Backbone

• Vector backbone: p15A
• Backbone size w/o insert (bp): 5000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Turbo
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: pAzFRS.2.t1
• Species: Synthetic
• Insert Size (bp): 921
• GenBank ID: KT996140

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: bglII (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: cataagattagcggatcctacctg
• 3′ sequencing primer: CTTCTGCGTTCTGATTTAATCTG

Gene/Insert 2

• Gene/Insert name: pAzFRS.2.t1
• Species: Synthetic
• GenBank ID: KT996140

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: ndeI (not destroyed)
• 3′ cloning site: pstI (not destroyed)
• 5′ sequencing primer: CAGATTAAATCAGAACGCAGAAG
• 3′ sequencing primer: cgaaagcaaattcgaccct

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: This plasmid exists as a tandem dimer approximately 12 kb in length. Please see the diagnostic digest in the Resource Information section.