pCW57.1 _3xHA-Ago2_CATmut
(Plasmid #73540)

• Purpose: Inducible lentiviral expression of Ago2_CATmut
• Depositing Lab: Constance Ciaudo
• Publication: Ngondo et al Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: David Root (Addgene plasmid # 41393)
• Backbone size w/o insert (bp): 9354
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable ; Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
• Growth instructions: Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ago2
• Species: M. musculus (mouse)
• Mutation: Catalytic mutant PIWI domain D670A
• Entrez Gene: Ago2 (a.k.a. 1110029L17Rik, 2310051F07Rik, Eif2c2, Gerp95, Gm10365, mKIAA4215)
• Promoter: TRE promoter, Tet ON
• Tag / Fusion Protein:
  • 3xHA (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: LNCX
• 3′ sequencing primer: GAACGGACGTGAAGAATGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector linearized using NheI/BamH1 sites. Insert cloned by recombination using In-Fusion cloning. Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.