Skip to main content
Addgene

pCW57.1 _3xHA-Ago2_RNAmut
(Plasmid #73539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    David Root (Addgene plasmid # 41393)
  • Backbone size w/o insert (bp) 9354
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ago2
  • Species
    M. musculus (mouse)
  • Mutation
    Small RNA binding mutant PAZ domain Y311A and F312A
  • Entrez Gene
    Ago2 (a.k.a. 1110029L17Rik, 2310051F07Rik, Eif2c2, Gerp95, Gm10365, mKIAA4215)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • 3xHA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer GAACGGACGTGAAGAATGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector linearized using NheI/BamH1 sites. Insert cloned by recombination using In-Fusion cloning. Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 _3xHA-Ago2_RNAmut was a gift from Constance Ciaudo (Addgene plasmid # 73539 ; http://n2t.net/addgene:73539 ; RRID:Addgene_73539)
  • For your References section:

    Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Ngondo RP, Cirera-Salinas D, Yu J, Wischnewski H, Bodak M, Vandormael-Pournin S, Geiselmann A, Wettstein R, Luitz J, Cohen-Tannoudji M, Ciaudo C. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023. 10.1016/j.stemcr.2017.12.023 PubMed 29396181