JH04
(Plasmid
#73513)
-
PurposemRuby2_PH pCFJ150 - contains C. elegans codon optimized mRuby2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemodified pCFJ150
- Total vector size (bp) 9601
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepmex-5::mRuby2::PH::tbb-2
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)9601
- Promoter mex-5
-
Tag
/ Fusion Protein
- mRuby2 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTTTCCGTTTTCTCATTGTATTCTCTC
- 3′ sequencing primer GAGGAGTTGGGATCCCTTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene was synthesized by IDT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JH04 was a gift from Bob Goldstein (Addgene plasmid # 73513 ; http://n2t.net/addgene:73513 ; RRID:Addgene_73513) -
For your References section:
Comparative assessment of fluorescent proteins for in vivo imaging in an animal model system. Heppert JK, Dickinson DJ, Pani AM, Higgins CD, Steward A, Ahringer J, Kuhn JR, Goldstein B. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394. doi: 10.1091/mbc.E16-01-0063. Epub 2016 Jul 6. 10.1091/mbc.E16-01-0063 PubMed 27385332