pgRNA-CKB
(Plasmid #73501)

• Purpose: gRNA expression vector (with mKate2)
• Depositing Lab: Bruce Conklin
• Publication: Mandegar et al Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10.

Backbone

• Vector backbone: pSico
• Total vector size (bp): 9596
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mKate2-T2A-Bsd
• gRNA/shRNA sequence: Scramble gRNA sequence with BsmBI cloning sites
• Species: H. sapiens (human), Synthetic
• Promoter: CAG
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTCTGCTAACCATGTTCATGC
• 3′ sequencing primer: GATCTACCACATTTGTAGAG

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Due to the large size of this gRNA expression vector it does not produce high-tire lentivirus. Hence we do not recommend using this plasmid backbone for lentivral preparation. This gRNA-expression plasmid is best suited for plasmid transfections and generation of stable clones.