pAAVS1-NDi-CRISPRi (Gen1)
(Plasmid #73497)

• Purpose: Dox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locus with mCherry marker
• Depositing Lab: Bruce Conklin
• Publication: Mandegar et al Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10.

Backbone

• Vector backbone: pAAVS1
• Backbone size w/o insert (bp): 3356
• Total vector size (bp): 13834
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dCas9-KRAB-P2A-mCherry
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 5255
• Mutation: D10A, H840A (catalytically deactivated Cas9)
• Promoter: TRE3G
• Tags / Fusion Proteins:
  • KRAB (N terminal on insert)
  • NLS (C terminal on insert)
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG
• 3′ sequencing primer: TGTGGAATTGTGAGCGGATA

Gene/Insert 2

• Gene/Insert name: rtTA
• Species: Synthetic
• Insert Size (bp): 853
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CTCTAGAGCCTCTGCTAACC
• 3′ sequencing primer: CAGAGGGAAAAAGATCTCAGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dCas9-KRAB fusion transgene was a gift from Stanley Qi
• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry