Skip to main content
Addgene

hPlekhm1-C/pIRES puro Glue (S778-A1056)
(Plasmid #73456)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73456 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIRES puro Glue vector
  • Backbone manufacturer
    Addgene, vector number 15100
  • Backbone size w/o insert (bp) 5481
  • Total vector size (bp) 6315
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plekhm1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    834
  • Entrez Gene
    PLEKHM1 (a.k.a. AP162, B2, OPTA3, OPTB6)
  • Tags / Fusion Proteins
    • strep tag (N terminal on backbone)
    • HA tag (N terminal on backbone)
    • CBP tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (unknown if destroyed)
  • 3′ cloning site Not1 (unknown if destroyed)
  • 5′ sequencing primer TGGCGAGAACCTGTACTTCCAG
  • 3′ sequencing primer CAAGTGTATGGCCAGATCTCAAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hPlekhm1-C/pIRES puro Glue (S778-A1056) was a gift from Paul Odgren (Addgene plasmid # 73456 ; http://n2t.net/addgene:73456 ; RRID:Addgene_73456)
  • For your References section:

    TRAFD1 (FLN29) Interacts with Plekhm1 and Regulates Osteoclast Acidification and Resorption. Witwicka H, Jia H, Kutikov A, Reyes-Gutierrez P, Li X, Odgren PR. PLoS One. 2015 May 19;10(5):e0127537. doi: 10.1371/journal.pone.0127537. eCollection 2015. 10.1371/journal.pone.0127537 PubMed 25992615