hPlekhm1_pIRES puro Glue
(Plasmid #73453)

• Purpose: Express human Plekhm1 in mammalian cells
• Depositing Lab: Paul Odgren
• Publication: Witwicka et al PLoS One. 2015 May 19;10(5):e0127537. doi: 10.1371/journal.pone.0127537. eCollection 2015.

Backbone

• Vector backbone: pIRES puro Glue vector
• Backbone manufacturer: Addgene, vector number 15100
• Backbone size w/o insert (bp): 5481
• Total vector size (bp): 8652
• Modifications to backbone: the original vector was digested with EcoRV and Not1 to insert Plekhm1
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Plekhm1
• Species: H. sapiens (human)
• Insert Size (bp): 3171
• GenBank ID: NM_014798.2
• Entrez Gene: PLEKHM1 (a.k.a. AP162, B2, OPTA3, OPTB6)
• Tags / Fusion Proteins:
  • strep tag (N terminal on backbone)
  • HA tag (N terminal on backbone)
  • CBP tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: TGGCGAGAACCTGTACTTCCAG
• 3′ sequencing primer: CAAGTGTATGGCCAGATCTCAAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry