pLas81-LuxI
(Plasmid
#73445)
-
PurposeHSL relay device: produces 3O-C6-HSL in response to 3O-C12-HSL
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSB6A1
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 3900
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuxI
-
SpeciesV. fischeri
-
Insert Size (bp)665
- Promoter pLas81
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgccacctgacgtctaaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRegistry of standard biological parts
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLas81-LuxI was a gift from Jim Haseloff (Addgene plasmid # 73445 ; http://n2t.net/addgene:73445 ; RRID:Addgene_73445) -
For your References section:
Orthogonal intercellular signaling for programmed spatial behavior. Grant PK, Dalchau N, Brown JR, Federici F, Rudge TJ, Yordanov B, Patange O, Phillips A, Haseloff J. Mol Syst Biol. 2016 Jan 25;12(1):849. PubMed 26814193
