pAdx-CMV-tdTomato
(Plasmid
#73347)
-
PurposeExpress tdTomato under CMV promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAdenoX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 32705
- Total vector size (bp) 34922
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCMV-tdTomato
-
Insert Size (bp)2218
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site I-CeuI (not destroyed)
- 3′ cloning site PI-SceI (not destroyed)
- 5′ sequencing primer AATCTTACTCGGTTACGCCC
- 3′ sequencing primer CGGCTGCTGCAAAACAGATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAdx-CMV-tdTomato was a gift from Kazuhiro Oka (Addgene plasmid # 73347 ; http://n2t.net/addgene:73347 ; RRID:Addgene_73347)